Review



aav vectors expressing shrna targeting chrebp  (VectorBuilder GmbH)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    VectorBuilder GmbH aav vectors expressing shrna targeting chrebp
    a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated <t>viruses</t> <t>(AAV)</t> -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.
    Aav Vectors Expressing Shrna Targeting Chrebp, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aav vectors expressing shrna targeting chrebp/product/VectorBuilder GmbH
    Average 90 stars, based on 1 article reviews
    aav vectors expressing shrna targeting chrebp - by Bioz Stars, 2026-02
    90/100 stars

    Images

    1) Product Images from "Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice"

    Article Title: Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice

    Journal: Nature Communications

    doi: 10.1038/s41467-025-61219-w

    a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.
    Figure Legend Snippet: a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

    Techniques Used: Gene Expression, Injection, Labeling



    Similar Products

    aav vectors expressing shrna targeting chrebp  (VectorBuilder GmbH)
    90
    VectorBuilder GmbH aav vectors expressing shrna targeting chrebp
    a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated <t>viruses</t> <t>(AAV)</t> -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.
    Aav Vectors Expressing Shrna Targeting Chrebp, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aav vectors expressing shrna targeting chrebp/product/VectorBuilder GmbH
    Average 90 stars, based on 1 article reviews
    aav vectors expressing shrna targeting chrebp - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    aav vectors expressing shrna that targets chrebp  (VectorBuilder GmbH)
    90
    VectorBuilder GmbH aav vectors expressing shrna that targets chrebp
    a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated <t>viruses</t> <t>(AAV)</t> -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.
    Aav Vectors Expressing Shrna That Targets Chrebp, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aav vectors expressing shrna that targets chrebp/product/VectorBuilder GmbH
    Average 90 stars, based on 1 article reviews
    aav vectors expressing shrna that targets chrebp - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

    Journal: Nature Communications

    Article Title: Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice

    doi: 10.1038/s41467-025-61219-w

    Figure Lengend Snippet: a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

    Article Snippet: AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively.

    Techniques: Gene Expression, Injection, Labeling